pEX18TC

PVT10636            Packing 2ug

pEX18TC Information

Carrier name: pEX18Tc, pEX-18Tc

Plasmid type: Suicide Plasmid

Cloning method: restriction endonuclease, polyclonal site

Promoter: Lac

Carrier size: 6349 BP

5'sequencing primers and sequences: M13F (-47) CGCCAGGGTTTTCCCAGTCACGAC

3'sequencing primers and sequences: M13R (-48) AGCGGATAACAATTTCACACAGGA

Carrier resistance: tetracycline

Virus / non virus: non viral

Function E.coli Editing plasmids

pEX18TC Reference
1. Biswas I., Mettlach J. (2019) Targeted Gene Replacement in Acinetobacter baumannii. In: Biswas I., Rather P. (eds) Acinetobacter baumannii. Methods in Molecular Biology, vol 1946. Humana Press, New York, NY

DOI   https://doi.org/10.1007/978-1-4939-9118-1_10
Publisher Name    Humana Press, New York, NY
 

Cloning vector pEX18Tc, complete sequence

Caution:
1.  This product is FOR RESEARCH USE ONLY!
2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.