Price List Default - EUR
  1. All Products
  2. icd-439F Forward Primer - 2x 250 nmol (Lyophilized)

icd-439F Forward Primer - 2x 250 nmol (Lyophilized)

https://www.gentaur.be/web/image/product.template/18590/image_1920?unique=b93a12c
(0 review)

Sequence (5' to 3'):
CGTTATTTTACGGGTGTGCCA

0.00 € 0.0 EUR 0.00 € VAT Excluded

142.00 € VAT Excluded

info@gentaur.com

    This combination does not exist.

    Contact Us For The Price

    Terms and Conditions
    30-day money-back guarantee
    Shipping: 2-3 Business Days

    Internal Reference: 1137-icd-439F_Forward_Primer
    Website URL: /shop/1137-icd-439f-forward-primer-icd-439f-forward-primer-2x-250-nmol-lyophilized-18590

    Sequence (5' to 3'):

    CGTTATTTTACGGGTGTGCCA

    Votre snippet dynamique sera affiché ici... Ce message est affiché parce que vous n'avez pas défini le filtre et le modèle à utiliser.