Skip to Content
Price List Default - EUR
  1. All Products
  2. Monkeypox virus dsDNA control (92 bp) - 200 nmol (HPLC Purified)
Monkeypox virus dsDNA control (92 bp) - 200 nmol (HPLC Purified)

Monkeypox virus dsDNA control (92 bp) - 200 nmol (HPLC Purified)

https://www.gentaur.be/web/image/product.template/22237/image_1920?unique=d621c77
(0 review)

Sense (5'-3') Sequence:

0.00 € 0.0 EUR 0.00 € Tax Excluded

info@gentaur.com

    This combination does not exist.

    Contact Us For The Price

    Terms and Conditions
    30-day money-back guarantee
    Shipping: 2-3 Business Days

    Share

    Internal Reference: 1137-MPXV_G2R_G-200NMOL
    Website URL: /shop/1137-mpxv-g2r-g-200nmol-monkeypox-virus-dsdna-control-92-bp-200-nmol-hplc-purified-22237

    Sense (5'-3') Sequence:
    TGGAAAGTGTAAAGACAACGAATACAGAAGCCGTAATCTATGTTGTCTATCGTGTCCTCCGGGAACTTACGCTTCCAGATTATGTGATAGCA
    Votre snippet dynamique sera affiché ici... Ce message est affiché parce que vous n'avez pas défini le filtre et le modèle à utiliser.