pET- 17b - 2ug
(0 avis)

335,00 € 335.0 EUR 335,00 € hors TVA

335,00 € hors TVA

Not Available For Sale

    Cette combinaison n'existe pas.

    Conditions générales
    Garantie satisfait ou remboursé de 30 jours
    Expédition : 2-3 jours ouvrables


    Search name

    pET-17b,Plasmid pET-17b,pET-17b vector



    pET-17b Information

    Promoter: T7

    Replicon: ColE1 ori

    Terminator: T7 Terminator

    Plasmid classification: large intestine plasmid; large intestine expression plasmid; pET series plasmid.

    Plasmid size: 3306bp

    Plasmid tagging: N-T7

    Prokaryotic resistance: ampicillin Amp (100 g/ml)

    Cloning strains: E. coli DH5 and E.

    Culture conditions: 37 C, aerobic, LB

    Expression host: E. coli BL21 (DE3).

    Culture conditions: 37 C, aerobic, LB

    Induction: IPTG or lactose and its analogues.

    5'sequencing primers: T7 (TAATACGACTCACTATAGGG)

    3'sequencing primers: T7-ter (TGCTAGTTATTGCTCAGCGG)


    pET-17b Description

    PET-17b plasmid is a prokaryotic expression vector, and the N end contains a T7 tag. The plasmid contains several commonly used restriction sites to facilitate cloning of different genes. The expression was induced by T7 RNA polymerase provided by host cells. The target gene was cloned into plasmid vector and controlled by strong transcription and translation signals of bacteriophages.

    PET system is the most powerful system to express recombinant proteins in E. coli, and it is also the most widely used system in prokaryotic expression nowadays. The plasmids can easily reduce protein expression by decreasing the concentration of inducers. Under non inducible conditions, the target gene can be completely silenced without transcribing.


    The pET-17b vector carries an N-terminal 11aa T7?Tag? sequence followed by a region of useful cloning sites. Included in the multiple cloning region are dual BstX I sites, which allow efficient cloning using an asymmetric linker. Unique sites (except for the two BstX I sites) are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circluar map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below.


    pET-17b Multiple cloning site


    pET-17b Sequence

    LOCUS       Exported                3306 bp ds-DNA     circular SYN 15-JUN-2017
    DEFINITION  synthetic circular DNA.
    KEYWORDS    pET-17b
    SOURCE      synthetic DNA construct
      ORGANISM  synthetic DNA construct
    REFERENCE   1  (bases 1 to 3306)
      TITLE     Direct Submission
      JOURNAL   Exported Thursday, June 15, 2017  
    FEATURES             Location/Qualifiers
         source          1..3306
                         /organism="synthetic DNA construct"
                         /mol_type="other DNA"
         promoter        104..208
                         /note="AmpR promoter"
         CDS             209..1069
                         /note="confers resistance to ampicillin, carbenicillin, and
                         related antibiotics"
         rep_origin      1240..1828
                         /note="high-copy-number colE1/pMB1/pBR322/pUC origin of
         CDS             complement(2258..2449)
                         /product="Rop protein"
         promoter        2958..2976
                         /note="T7 promoter"
                         /note="promoter for bacteriophage T7 RNA polymerase"
         CDS             3038..3070
                         /product="leader peptide from bacteriophage T7 gene 10"
                         /note="T7 tag (gene 10 leader)"
                         /note="promotes efficient translation in E. coli"
         misc_feature    3079..3166
         terminator      3232..3279
                         /note="T7 terminator"
                         /note="transcription terminator for bacteriophage T7 RNA
            1 ttcttgaaga cgaaagggcc tcgtgatacg cctattttta taggttaatg tcatgataat
           61 aatggtttct tagacgtcag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg
          121 tttatttttc taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat
          181 gcttcaataa tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat
          241 tccctttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt
          301 aaaagatgct gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag
          361 cggtaagatc cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa
          421 agttctgcta tgtggcgcgg tattatcccg tgttgacgcc gggcaagagc aactcggtcg
          481 ccgcatacac tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct
          541 tacggatggc atgacagtaa gagaattatg cagtgctgcc ataaccatga gtgataacac
          601 tgcggccaac ttacttctga caacgatcgg aggaccgaag gagctaaccg cttttttgca
          661 caacatgggg gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat
          721 accaaacgac gagcgtgaca ccacgatgcc tgcagcaatg gcaacaacgt tgcgcaaact
          781 attaactggc gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc
          841 ggataaagtt gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga
          901 taaatctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg
          961 taagccctcc cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg
         1021 aaatagacag atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca
         1081 agtttactca tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta
         1141 ggtgaagatc ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca
         1201 ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg
         1261 cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga
         1321 tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa
         1381 tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc
         1441 tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg
         1501 tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac
         1561 ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct
         1621 acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc
         1681 ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg
         1741 gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg
         1801 ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct
         1861 ggccttttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga
         1921 taaccgtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg
         1981 cagcgagtca gtgagcgagg aagcggaaga gcgcctgatg cggtattttc tccttacgca
         2041 tctgtgcggt atttcacacc gcatatatgg tgcactctca gtacaatctg ctctgatgcc
         2101 gcatagttaa gccagtatac actccgctat cgctacgtga ctgggtcatg gctgcgcccc
         2161 gacacccgcc aacacccgct gacgcgccct gacgggcttg tctgctcccg gcatccgctt
         2221 acagacaagc tgtgaccgtc tccgggagct gcatgtgtca gaggttttca ccgtcatcac
         2281 cgaaacgcgc gaggcagctg cggtaaagct catcagcgtg gtcgtgaagc gattcacaga
         2341 tgtctgcctg ttcatccgcg tccagctcgt tgagtttctc cagaagcgtt aatgtctggc
         2401 ttctgataaa gcgggccatg ttaagggcgg ttttttcctg tttggtcact gatgcctccg
         2461 tgtaaggggg atttctgttc atgggggtaa tgataccgat gaaacgagag aggatgctca
         2521 cgatacgggt tactgatgat gaacatgccc ggttactgga acgttgtgag ggtaaacaac
         2581 tggcggtatg gatgcggcgg gaccagagaa aaatcactca gggtcaatgc cagcgcttcg
         2641 ttaatacaga tgtaggtgtt ccacagggta gccagcagca tcctgcgatg cagatccgga
         2701 acataatggt gcagggcgct gacttccgcg tttccagact ttacgaaaca cggaaaccga
         2761 agaccattca tgttgttgct caggtcgcag acgttttgca gcagcagtcg cttcacgttc
         2821 gctcgcgtat cggtgattca ttctgctaac cagtaaggca accccgccag cctagccggg
         2881 tcctcaacga caggagcacg atcatgcgca cccgtggcca ggacccaacg ctgcccgaga
         2941 tctcgatccc gcgaaattaa tacgactca