pBbA5c-MevT(CO)-T1-MBIS(CO, ispA) plasmid - 2ug

https://www.gentaur.be/web/image/product.template/1994/image_1920?unique=a6ee4eb
(0 avis)

330,00 € 330.0 EUR 330,00 € hors TVA

330,00 € hors TVA

Not Available For Sale

    Cette combinaison n'existe pas.

    Conditions générales
    Garantie satisfait ou remboursé de 30 jours
    Expédition : 2-3 jours ouvrables

    pBbA5c-MevT(CO)-T1-MBIS(CO, ispA)

     

    Product Name: pBbA5c-MevT(CO)-T1-MBIS(CO, ispA)
    Cat No.: PVT17450
    Alternative Name: pBbA5c-MevT(CO)-T1-MBIS(CO, ispA),pBbA5c-MevT(CO)-T1-MBIS(CO, ispA) vector,pBbA5c-MevT(CO)-T1-MBIS(CO, ispA) plasmid,pBbA5c-MevT(CO)-T1-MBIS(CO, ispA) map,pBbA5c-MevT(CO)-T1-MBIS(CO, ispA) sequence
    Plasmid form: Freeze-dried powder
    Storage Condition: -20 Centigrade
    Bulk order Please contact us: sales@lifescience-market.com
    Promoter: inquiry
    Bacterial Resistance(s): Chl
    Screening: inquiry
    Growth Strain(s): DH5alpha
    Culture Medium: LB
    Temperature: 37 Centigrade
    Vector Size: 13541bp
     

    pBbA5c-MevT(CO)-T1-MBIS(CO, ispA) Sequence

    gacgtcggtgcctaatgagtgagctaacttacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgccagggtggtttttcttttcaccagtgagacgggcaacagctgattgcccttcaccgcctggccctgagagagttgcagcaagcggtccacgctggtttgccccagcaggcgaaaatcctgtttgatggtggttaacggcgggatataacatgagctgtcttcggtatcgtcgtatcccactaccgagatgtccgcaccaacgcgcagcccggactcggtaatggcgcgcattgcgcccagcgccatctgatcgttggcaaccagcatcgcagtgggaacgatgccctcattcagcatttgcatggtttgttgaaaaccggacatggcactccagtcgccttcccgttccgctatcggctgaatttgattgcgagtgagatatttatgccagccagccagacgcagacgcgccgagacagaacttaatgggcccgctaacagcgcgatttgctggtgacccaatgcgaccagatgctccacgcccagtcgcgtaccgtcttcatgggagaaaataatactgttgatgggtgtctggtcagagacatcaagaaataacgccggaacattagtgcaggcagcttccacagcaatggcatcctggtcatccagcggatagttaatgatcagcccactgacgcgttgcgcgagaagattgtgca
    ccgccgctttacaggcttcgacgccgcttcgttctaccatcgacaccaccacgctggcacccagttgatcggcgcgagatttaatcgccgcgacaatttgcgacggcgcgtgcagggccagactggaggtggcaacgccaatcagcaacgactgtttgcccgccagttgttgtgccacgcggttgggaatgtaattcagctccgccatcgccgcttccactttttcccgcgttttcgcagaaacgtggctggcctggttcaccacgcgggaaacggtctgataagagacaccggcatactctgcgacatcgtataacgttactggtttcacattcaccaccctgaattgactctcttccgggcgctatcatgccataccgcgaaaggttttgcgccattcgatggtgtccgggatctcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggatcgagatcgtttaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggaattgtgagcggataacaatttcagaattcaaaagatctaaaggaggccatcctggccatgaagaactgtgtgattgtttctgcggtccgcacggcgatcggcagctttaacggctctttagcgagcacctctgcaatcgatctgggtgcgacggtcattaaggccgccattgaacgcgccaaaatcgacagccagcacgttgatgaggtgatcatgggcaatgtgttacaagccggcctgggtcaaaacccagcgcgtcaagcactgttaaaatctggtctggccgagaccgtgtgtggcttcaccgtcaataaggtttgcggctctggcctgaagagcgtggccctggcagcacaagcgattcaagccggtcaggcacaaagcatcgttgcgggtggcatggagaacatgtctctggcgccgtacttattagatgccaaagcccgcagcggttatcgcctgggcgatggtcaggtgtacgacgtcatcttacgcgatggcttaatgtgcgcgacccacggttaccacatgggtattacggccgaaaacgtggcgaaagaatacggcattacgcgcgagatgcaggatgaattagcactgcactctcagcgcaaagcagcagccgcgatcgagtctggtgcgtttacggcggaaatcgtgccagttaacgtggtcacgcgcaagaagacgttcgttttcagccaggacgagttcccgaaggcaaacagcaccgcggaggccttaggtgccttacgcccagcctttgacaaagcgggcacggtcaccgccggtaatgcgagcggcatcaatgatggtgcagcggcactggtcatcatggaagagagcgccgcattagcagcgggtctgaccccattagcgcgcattaaatcttatgccagcggcggcgtcccaccagccctgatgggcatgggtccggtcccagccacgcaaaaagccctgcaattagcgggcctgcaactggccgacattgatctgatcgaggcgaacgaggcgtttgcagcgcagttcctggcggtgggtaagaatctgggcttcgacagcgagaaagtcaatgtgaacggtggcgcgattgcgttaggccatccgattggtgcaagcggcgcacgcatcttagtgacgttactgcacgccatgcaggcacgcgacaagaccttaggcctggcgaccttatgtattggtggcggtcaaggtatcgccatggtgatcgaacgcctgaactgatgaaggaggaaagcaaaatgaaactgagcaccaagctgtgctggtgtggcatcaagggtcgcctgcgcccacaaaagcagcaacagctgcacaacacgaacctgcaaatgaccgagctgaaaaagcagaagacggccgagcaaaagacccgcccgcagaacgttggcatcaagggcatccagatttatatcccgacgcagtgtgtcaaccaatctgagctggagaaattcgatggcgtcagccagggtaagtacaccatcggcctgggccagaccaacatgagcttcgtgaacgaccgtgaggacatctattctatgagcctgacggtgctgtctaagctgatcaagagctacaacatcgacacgaataagatcggtcgtctggaggtgggtacggagacgctgattgacaagagcaaaagcgtgaagtctgtcttaatgcagctgttcggcgagaacacggatgtcgagggtatcgacaccctgaacgcgtgttacggcggcaccaacgcactgttcaatagcctgaactggattgagagcaacgcctgggatggccgcgatgcgatcgtcgtgtgcggcgatatcgccatctatgacaagggtgcggcacgtccgaccggcggtgcaggcaccgttgcgatgtggattggcccggacgcaccaattgtcttcgattctgtccgcgcgtcttacatggagcacgcctacgacttttacaagccggacttcacgagcgaatacccgtacgtggacggccacttctctctgacctgctatgtgaaggcgctggaccaggtttataagtcttatagcaaaaaggcgatttctaagggcctggtcagcgacccggcaggcagcgacgccctgaacgtgctgaagtatttcgactacaacgtgttccatgtcccgacctgcaaattagtgaccaaatcttatggccgcctgttatataatgatttccgtgccaacccgcagctgttcccggaggttgacgccgagctggcgacgcgtgattacgacgagagcctgaccgacaagaacatcgagaagaccttcgtcaacgtcgcgaagccgttccacaaagagcgtgtggcccaaagcctgatcgtcccgaccaacacgggcaacatgtataccgcgtctgtctacgcggcattcgcgagcctgctgaattacgtcggttctgacgacctgcagggcaagcgcgttggcctgttcagctacggtagcggcttagcggccagcctgtatagctgcaaaattgtcggcgacgtccagcacatcatcaaggagctggacatcaccaacaagctggcgaagcgcatcaccgagacgccgaaagattacgaggcagcgatcgagttacgcgagaatgcgcatctgaagaagaacttcaagccgcaaggtagcatcgagcacctgcagagcggcgtctactacctgacgaacattgacgacaagttccgccgttcttatgacgtcaaaaagtaactagtaggaggaaaacatcatggtgctgacgaacaaaaccgtcattagcggcagcaaggtgaagtctctgagcagcgcccaaagctctagcagcggcccgtctagcagcagcgaggaggacgacagccgtgacattgagtctctggacaagaagatccgcccgctggaggagttagaggccctgctgagcagcggcaacaccaagcagctgaagaacaaggaagttgcagcgctggtgatccacggtaagctgccactgtatgcgctggaaaagaaactgggcgatacgacgcgtgcggtcgcggtgcgtcgcaaagccttaagcatcttagcggaggccccggtgttagccagcgaccgcctgccgtacaagaactacgactacgaccgcgtgtttggcgcgtgctgcgagaatgtcattggctacatgccgttaccggttggtgtgatcggcccgctggtcattgatggcacgagctatcacattccaatggcgaccacggaaggttgcttagtcgccagcgccatgcgtggctgtaaggcgattaacgccggcggtggcgcgacgaccgtgttaaccaaggatggtatgacgcgcggtccggtcgtccgcttcccaacgctgaagcgcagcggcgcgtgtaagatttggctggattctgaggagggccaaaacgcgatcaagaaagccttcaactctacgagccgtttcgcgcgtttacagcatatccagacctgcctggccggcgacctgctgttcatgcgcttccgcaccaccacgggcgatgcgatgggcatgaacatgatcagcaagggcgtcgaatatagcctgaaacaaatggtggaagaatatggctgggaggacatggaggttgtctctgtgagcggcaactattgcaccgacaagaagccggcagccattaactggattgagggtcgcggcaaaagcgtcgtggcagaagcgaccatcccaggcgacgtggtccgtaaggttctgaagagcgacgtcagcgccctggttgagttaaatatcgcgaaaaacctggtcggcagcgcgatggcgggcagcgtgggtggctttaacgcacatgcagcgaatctggttacggcggttttcttagccttaggtcaggacccagcccaaaatgtcgagagcagcaactgcattaccttaatgaaagaggttgacggtgacctgcgcatcagcgtttctatgccgtctatcgaggtcggcacgatcggcggcggcaccgttttagaaccgcaaggtgcgatgctggatctgctgggcgtgcgcggcccacatgcaacggccccaggcaccaatgcccgccaactggcccgtatcgtggcctgcgcggttctggcgggtgagctgagcctgtgcgccgcattagccgcgggccatttagttcaatctcacatgacccacaaccgcaagccggcagaaccaaccaagccaaataactggacgcaaccgacattaaccgtctgaaggatggcagcgtcacgtgcattaaaagctgatgaggatctttttaaggatctccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatagcgaattgatctggtttgacagcttatcatcgactgcacggtgcaccaatgcttctggcgtcaggcagccatcggaagctgtggtatggctgtgcaggtcgtaaatcactgcataattcgtgtcgctcaaggcgcactcccgttctggataatgttttttgcgccgacatcataacggttctggcaaatattctgaaatgagctgttgacaattaatcatccggctcgtataatgtgtggaattgtgagcggataacaatttcaggatctaggaggaaataaccatgtctctgccattcctgacgtctgcgccaggtaaggtgatcatcttcggcgagcactctgcggtgtacaataagccggccgtcgccgcctctgtgtctgcgttacgcacctacctgctgatcagcgaatcttctgcaccggacacgatcgagctggactttccggacatcagcttcaaccacaagtggagcatcaacgacttcaacgcgatcacggaggaccaggtgaacagccaaaagctggccaaagcccagcaagcaaccgacggtctgtctcaggagctggtgtctctgctggacccgctgttagcgcagttaagcgagagcttccattaccacgccgcgttctgcttcctgtacatgttcgtttgcctgtgcccgcacgcaaagaacatcaagttcagcctgaagagcacgctgccgattggcgcaggcttaggctctagcgcatctatcagcgtgagcctggcgctggcgatggcctatctgggtggcctgattggcagcaacgacctggagaaactgagcgaaaacgacaagcacatcgtgaaccagtgggcctttatcggcgagaagtgcattcatggcaccccgagcggcattgacaacgcagttgccacgtatggcaacgccctgctgttcgagaaagacagccacaacggcacgatcaacacgaacaacttcaagttcctggacgacttcccggcgatcccgatgattctgacctacacccgtatcccacgcagcaccaaggatttagtcgcccgcgtgcgtgttttagtcaccgaaaagttcccggaggtgatgaagccgatcctggacgcgatgggcgagtgcgcgctgcagggtctggagatcatgaccaagctgagcaagtgcaagggcaccgacgatgaggcggtggagaccaacaatgagctgtacgagcagctgctggagctgatccgtatcaatcacggcctgctggtctctatcggtgtgtctcacccgggcctggaactgatcaaaaacctgagcgacgacctgcgcattggctctacgaaattaacgggtgcaggtggcggtggctgctctttaacgctgctgcgccgtgacattacgcaggagcaaatcgacagcttcaagaagaagctgcaggacgacttcagctacgagacgttcgagacggacctgggcggcacgggctgttgcctgctgagcgccaaaaatctgaacaaggacctgaagatcaaaagcctggtgttccagctgttcgaaaacaagacgaccacgaagcagcagatcgacgacctgttactgccgggtaacaccaatctgccgtggacgtcttaaggatctaggagggagatcatatgagcgaattacgtgcattcagcgcgccaggtaaggcactgctggccggtggctacctggtgttagacaccaagtacgaggcgttcgtcgtcggcttatctgcccgtatgcatgcagttgcccacccgtatggtagcctgcagggctctgacaagttcgaagtgcgtgtgaagagcaagcagttcaaggacggcgagtggctgtaccacattagcccaaagagcggcttcatcccggttagcattggtggcagcaagaacccatttatcgagaaggtcattgccaacgtcttcagctacttcaagccgaatatggacgattactgcaaccgcaacctgttcgtcatcgacattttcagcgacgacgcgtaccacagccaagaggactctgttacggagcatcgtggtaaccgccgcctgagcttccacagccatcgcattgaggaggtgccgaagacgggtctgggttctagcgccggtttagttaccgtcttaacgacggcgttagcgagcttcttcgtgagcgacctggagaacaacgtggacaagtaccgcgaagtgattcataacctggcgcaggtggcacattgtcaggcccaaggtaagattggctctggttttgatgtggcagcggccgcctatggctctatccgctatcgccgctttccgccggccctgatcagcaatctgccggacatcggctctgcgacgtatggtagcaaactggcgcatctggtggacgaggaggactggaacatcaccattaagtctaatcacctgccgagcggcttaacgttatggatgggcgatatcaagaacggcagcgaaacggttaagctggtgcagaaagtgaaaaactggtacgacagccacatgccggaaagcctgaagatttacacggagctggaccacgccaatagccgtttcatggatggtctgagcaagctggaccgcctgcacgaaacccacgacgactacagcgaccaaatcttcgagagcctggagcgcaatgactgcacctgccagaagtacccggagatcacggaggtccgcgatgccgtggcaacgattcgccgtagcttccgcaaaattacgaaggagagcggcgcggatatcgaaccaccggtccagacgtctctgctggacgactgtcaaaccttaaagggcgtgttaacgtgcctgattccgggcgcgggtggttacgacgccattgccgtcatcacgaaacaggacgtcgatctgcgcgcacaaacggccaacgacaaacgtttcagcaaagtccaatggctggatgttacgcaggccgactggggtgttcgcaaggagaaggacccggaaacgtatctggataagtgaggatctaggaggattatgagatgaccgtttacacagcatccgttaccgcacccgtcaacatcgcaacccttaagtattgggggaaaagggacacgaagttgaatctgcccaccaattcgtccatatcagtgactttatcgcaagatgacctcagaacgttgacctctgcggctactgcacctgagtttgaacgcgacactttgtggttaaatggagaaccacacagcatcgacaatgaaagaactcaaaattgtctgcgcgacctacgccaattaagaaaggaaatggaatcgaaggacgcctcattgcccacattatctcaatggaaactccacattgtctccgaaaataactttcctacagcagctggtttagcttcctccgctgctggctttgctgcattggtctctgcaattgctaagttataccaattaccacagtcaacttcagaaatatctagaatagcaagaaaggggtctggttcagcttgtagatcgttgtttggcggatacgtggcctgggaaatgggaaaagctgaagatggtcatgattccatggcagtacaaatcgcagacagctctgactggcctcagatgaaagcttgtgtcctagttgtcagcgatattaaaaaggatgtgagttccactcagggtatgcaattgaccgtggcaacctccgaactatttaaagaaagaattgaacatgtcgtaccaaagagatttgaagtcatgcgtaaagccattgttgaaaaagatttcgccacctttgcaaaggaaacaatgatggattccaactctttccatgccacatgtttggactctttccctccaatattctacatgaatgacacttccaagcgtatcatcagttggtgccacaccattaatcagttttacggagaaacaatcgttgcatacacgtttgatgcaggtccaaatgctgtgttgtactacttagctgaaaatgagtcgaaactctttgcatttatctataaattgtttggctctgttcctggatgggacaagaaatttactactgagcagcttgaggctttcaaccatcaatttgaatcatctaactttactgcacgtgaattggatcttgagttgcaaaaggatgttgccagagtgattttaactcaagtcggttcaggcccacaagaaacaaacgaatctttgattgacgcaaagactggtctaccaaaggaataaggatctaggaggtaatgataatgcaaacggaacacgtcattttattgaatgcacagggagttcccacgggtacgctggaaaagtatgccgcacacacggcagacacccgcttacatctcgcgttctccagttggctgtttaatgccaaaggacaattattagttacccgccgcgcactgagcaaaaaagcatggcctggcgtgtggactaactcggtttgtgggcaccacaactgggagaaagcaacgaagacgcagtgatccgccgttgccgttatgagcttggcgtggaaattacgcctcctgaatctatctatcctgactttcgctaccgcgccaccgatccgagtggcattgtggaaaatgaagtgtgtccggtatttgccgcacgcaccactagtgcgttacagatcaatgatgatgaagtgatggattatcaatggtgtgatttagcagatgtattacacggtattgatgccacgccgtgggcgttcagtccgtggatggtgatgcaggcgacaaatcgcgaagccagaaaacgattatctgcatttacccagcttaaataaggatctaggaggataaagaaatggactttccgcagcaactcgaagcctgcgttaagcaggccaaccaggcgctgagccgttttatcgccccactgccctttcagaacactcccgtggtcgaaaccatgcagtatggcgcattattaggtggtaagcgcctgcgacctttcctggtttatgccaccggtcatatgttcggcgttagcacaaacacgctggacgcacccgctgccgccgttgagtgtatccacgcttactcattaattcatgatgatttaccggcaatggatgatgacgatctgcgtcgcggtttgccaacctgccatgtgaagtttggcgaagcaaacgcgattctcgctggcgacgctttacaaacgctggcgttctcgattttaagcgatgccgatatgccggaagtgtcggaccgcgacagaatttcgatgatttctgaactggcgagcgccagtggtattgccggaatgtgcggtggtcaggcattagatttagacgcggaaggcaaacacgtacctctggacgcgcttgagcgtattcatcgtcataaaaccggcgcattgattcgcgccgccgttcgccttggtgcattaagcgccggagataaaggacgtcgtgctctgccggtactcgacaagtatgcagagagcatcggccttgccttccaggttcaggatgacatcctggatgtggtgggagatactgcaacgttgggaaaacgccagggtgccgaccagcaacttggtaaaagtacctaccctgcacttctgggtcttgagcaagcccggaagaaagcccgggatctgatcgacgatgcccgtcagtcgctgaaacaactggctgaacagtcactcgatacctcggcactggaagcgctagcggactacatcatccagcgtaataaataaggatcctaatgaggatccaaactcgagtaaggatctccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatacctagggatatattccgctcctcgctcactgactcgctacgctcggtcgttcgactgcggcgagcggaaatggcttacgaacggggcggagatttcctggaagatgccaggaagatacttaacagggaagtgagagggccgcggcaaagccgtttttccataggctccgccccctgacaagcatcacgaaatctgacgctcaaatcagtggtggcgaaacccgacaggactataaagataccaggcgtttccccctggcggctccctcgtgcgctctcctgttcctgcctttcggtttaccggtgtcattccgctgttatggccgcgtttgtctcattcacgcctgacactcagttccgggtaggcagttcgctccaagctggactgtatgcacgaaccccccgttcagtccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggaaagacatgcaaaagcaccactggcagcagccatggtaattgatttagaggagttagtcttgaagtcatgcgccggttaaggctaaactgaaaggacaagttttggtgactgcgctcctccaagccagttacctcggttcaaagagttggtagctcagagaaccttcgaaaaaccgccctgcaaggcggttttttcgttttcagagcaagagattacgcgcagaccaaaacgatctcaagaagatcatcttattaatcagataaaatatttctagatttcagtgcaatttatctcttcaaatgtagcacctgaagtcagccccatacgatataagttgttactagtgcttggattctcaccaataaaaaacgcccggcggcaaccgagcgttctgaacaaatccagatggagttctgaggtcattactggatctatcaacaggagtccaagcgagctcgatatcaaattacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacgaaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgatactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccagatatc
    //

    Caution:
    1.  This product is FOR RESEARCH USE ONLY!
    2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.Take 2ul plasmid into 100 μ L corresponding competent cell, centrifugal then full coating on plate.
    3.  Shipping temperature is 2-8℃.